Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: Late-onset SMA spinal cord analyses showed an increased expression of Cx43 compared to WT. ( A ) Spinal cord slices of SMA and WT mice at ages P20, P35, and p > 100 ( n = 4–5 animals) were stained for Cx43 (green). ( B – D ) Imaging studies showed an increased expression of Cx43 in SMA at P20 (** p = 0.0035). This increased expression was also visible at P35 and p > 100 (** p = 0.0094 and p = 0.0071, respectively). Higher accumulation of Cx43 was evident around motor neurons, particularly in SMA, pointed out in the SMA P35 image. Scale bar 20 μm. ( E ) For WB studies, lumbar spinal cord tissue of n = 3–4 animals was used. Results were then adjusted to the total protein value. ( F – H ) At P35 (* p = 0.0309) and p > 100 (** p = 0.0037), Cx43 expression was increased in SMA compared to WT. At P20, we found no difference in the Cx43 expression ( p = 0.1115). Analysis was conducted using unpaired Student’s t -tests. Full blots are shown in the Additional file. Abbreviations: SMA, spinal muscular atrophy; WB, Western blot; WT, wild-type; P, postnatal day.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Expressing, Staining, Imaging, Western Blot

Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: qPCR analyses showed an increase in Cx43 mRNA expression early in the pathogenesis. ( A ) Whole lumbar spinal cord tissue of SMA and WT mice at P20, P35, and p > 100 were prepared, and qPCR analyses were performed. The results suggested an increase in mRNA expression at P20 in SMA compared to WT (* p = 0.029). ( B , C ) No significant difference was visible between SMA and WT at later stages (P35, p = 0.9485; p > 100, p = 0.0542). n = 3 individual animals, analysis was conducted using unpaired Student’s t -tests. Abbreviations: SMA, spinal muscular atrophy; qPCR, quantitative polymerase chain reaction; WT, wild-type; P, postnatal day.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Expressing, Real-time Polymerase Chain Reaction

Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: Overexpression of Cx43 in a model of in vitro-induced SMN-deficiency in astrocytes. ( A ) Astrocytic cultures were prepared from the lumbar part of the spinal cord of WT mice and transfected with SMN-siRNA to induce SMN-deficiency. Appropriate control cultures were transfected with scr-siRNA and fluorescence imaging was conducted (created with bioRender.com). ( B , C ) GFAP (green) and DAPI (blue) staining of the same cultures demonstrated an astrocyte proportion of >98% compared to all viable cells; n = four individual cultures for each of the three animals, scale bar 50 μm. ( D , E ) Immunostaining of Cx43 (green) in transfected astrocytes. Analysis showed a 1.6-fold increase in Cx43 expression in SMN-deficient cells compared to the control (* p = 0.03; n = three independent experiments for each of the three individual animals, analysis was conducted using unpaired Student’s t -tests, scale bar 50 μm. Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; GFAP, glial fibrillary acidic protein; siRNA, small interfering RNA; SMN, survival of motor neuron; WT, wild-type.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Over Expression, In Vitro, Transfection, Control, Fluorescence, Imaging, Staining, Immunostaining, Expressing, Small Interfering RNA

Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: SMN deficient hiAstrocytes showed a higher Cx43 expression compared to the control, reversible by Gap27. ( A , B ) Culture clarity and iPSC induction success were proven by GFAP staining, showing >98% astrocytes in the cultures. ( C , D ) hiAstrocytes were transfected with SMN-siRNA to induce SMN deficiency. Appropriate controls were transfected with scr-siRNA. Staining for SMN showed an effective decrease compared to the control (*** p = 0.0006). ( E , F ) Staining for Cx43 showed an increased expression after SMN-knockdown (** p = 0.02), which was reduced after treatment with the Cx43 inhibitor Gap27 (*** p = 0.0009). n = three to seven independent experiments, analysis was conducted using unpaired Student’s t -tests and ANOVA, scale bar 50 μm. Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; E, embryonal day; SMA, spinal muscular atrophy; WT, wild-type.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Expressing, Control, Staining, Transfection, Knockdown

Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: Inhibition of Cx43 in SMA slice cultures led to significantly lower WT-like Ca 2+ response in murine MN. ( A , B ) 24 h incubation of WT MNs with the SN from SMA slice cultures (SMA) caused a significant increase in the Ca 2+ response compared to incubation with the SN from WT mice slice culture (Control) (** p = 0.0076), measured by Fluo-4 staining to visualize Ca 2+ processes (green). MNs incubated with SMA slice culture SN that had Cx43 inhibited (SMA + Gap27) caused a significant decrease in the Ca 2+ response compared to incubation with the untreated SMA supernatant (** p = 0.002). SMA + Gap27 SN showed a result comparable to the control ( p = 0.82). n = three independent experiments, scale bar 100 μm. ( C , D ) After acquiring the results from ( A ), the change in the spontaneous Ca 2+ response in MNs to SN of SMA or SMA + Gap27 slice cultures was measured. Acute introduction of SMA + Gap27 slice culture supernatant to WT MNs (application at 500 frames = 1 min) showed a significant decrease in Ca 2+ spike amplitude compared to treatment with the SMA supernatant, visualized with Fluo-4 staining in all vial cells (* p < 0.05). ( E ) ΔF/F0 calcium imaging traces of SMA and SMA + Gap27 MN. ( F ) AUC of ΔF/F0 calcium imaging traces displayed in mean with 95% CI. MN treated with supernatant (SMA + Gap27) showed a reduced AUC (*** p < 0.001). n = three cell cultures per condition, each consisting of six embryonic mice, with at least 30 cells/experiment/condition measured. Scale bar 10 μm, analysis was conducted using unpaired Student’s t -tests and ANOVA. Abbreviations: MN, motor neuron; SMA, spinal muscular atrophy; SN, supernatant; WT, wild-type.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Inhibition, Incubation, Control, Staining, Imaging

Journal: Cells

Article Title: Targeting Astrocytic Connexin 43 Mitigates Glutamate-Driven Motor Neuron Stress in Late-Onset Spinal Muscular Atrophy

doi: 10.3390/cells14231852

Figure Lengend Snippet: Glutamate assay showed increased expression in SMA, reversible by inhibiting Cx43. ( A ) Slice cultures showed higher glutamate levels in SMA compared to WT (*** p < 0.001). Gap27 treatment (200 µM) in SMA resulted in a decrease in glutamate levels (*** p < 0.001) to the level of WT ( p = 0.1). ( B ) Murine cell cultures also showed higher glutamate levels when SMN was knocked down (*** p < 0.001), with the levels decreasing with 200 µM Gap27 (*** p < 0.001) to the level of WT ( p = 0.85). ( C ) Similarly, hiAstrocytes showed increased glutamate levels when SMN was knocked down (*** p < 0.001). This significantly decreased after treatment with 200 µM Gap27 ( p < 0.001) to the level of the control ( p = 0.92). Analysis was conducted using unpaired Student’s t -tests. Abbreviations: SMA, spinal muscular atrophy; SMN, survival of motor neuron; WT, wild-type. hiAstrocytes, human induced astrocytes.

Article Snippet: Expression levels of the Cx43 gene GJA1 (forward primer: GGTGATGAACAGTCTGCCTTTCG, reverse primer: GTGAGCCAAGTACAGGAGTGTG; # MP205239 , OriGene, Rockville, MD, USA) were quantified through real-time quantitative polymerase chain reaction (qPCR) analysis utilizing Power SYBRTM Green PCR Master Mix (#4,367,659, Applied Biosystems, Waltham, MA, USA).

Techniques: Glutamate Assay, Expressing, Control

Journal: Cells

Article Title: The Role of NLRP3 in Regulation of Antimicrobial Peptides and Estrogen Signaling in UPEC-Infected Bladder Epithelial Cells

doi: 10.3390/cells12182298

Figure Lengend Snippet: Gene expression of antimicrobial peptides. Cas9 and NLRP3-deficient (NLRP3 gRNA) bladder epithelial cells were stimulated with 1 nM or 10 nM estradiol for 24 h, followed by analysis of DEFB1 ( A ), DEFB4A ( B ), CAMP ( C ), Lactoferrin ( D ), RNASE6 ( E ), RNASE7 ( F ) mRNA expression. The gene expression was normalized to GAPDH and expressed as fold change relative to unstimulated Cas9 controls. Data are presented as mean ± SEM of three independent experiments. Asterisks show statistical significance compared to unstimulated control (* p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Walthman, MA, USA) was used for the real time-RT-PCR, with 250 nM of each primer DEFB1 (HP208395), DEFB4A (HP208178), CAMP (HP207673), Lactoferrin (HP206049), RNASE6 (HP208722), RNASE7 (HP216036) (OriGene, MD, USA) and 5 ng cDNA.

Techniques: Gene Expression, Expressing, Control

Journal: Nature Communications

Article Title: Pre-symptomatic Caspase-1 inhibitor delays cognitive decline in a mouse model of Alzheimer disease and aging

doi: 10.1038/s41467-020-18405-9

Figure Lengend Snippet: a Il-1β and Il-18 mRNA levels in the hippocampus at 4-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice), 12-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice) and 20-week ( n = 4 mice per group) WO. b IL-1β western blots showing hippocampal inactive (pro-) and active (Δ) IL-1β per group at 4- and 20-week WO. c – h IL-1β western blot quantification in the hippocampus and cortex comparing ( c , f ) pro IL-1β, ( d , g ) ΔIL-1β and ( e , h ) total IL-1β at ( c – e ) 4-week WO, and ( f – h ) 20-week WO [cortical ΔIL-1β 20-week WO F(2,7) = 12.03, p = 0.0054, ANOVA, Dunnett’s post hoc compared to WT + vehicle]. In ( c – h ), n = 7 mice per group in 4-week WO hippocampus; n = 8 WT + veh, 7 J20 + veh, 7 J20 + VX mice in 20-week WO hippocampus; n = 3 per group in 4- and 20-week WO cortex. i ELISA measuring total hippocampal and cortical IL-1β levels at 4-week ( n = 7 WT + veh, 7 J20 + veh, 8 J20 + VX mice), 12-week ( n = 8 WT + veh, 6 J20 + veh, 7 J20 + VX mice) and 20-week ( n = 8 WT + veh, 7 J20 + veh, 7 J20 + VX mice) WO. j Casp1 and Casp6 mRNA levels in the hippocampus at 4-week ( n = 4 WT + veh, 3 J20 + veh, 3 J20 + VX mice), 12- ( n = 4 WT + veh, n J20 + veh, 3 J20 + VX mice) and 20-week ( n = 4 mice per group) WO. Data represents mean and s.e.m. ** p < 0.01.

Article Snippet: Casp1 (MP201790) and Casp6 (MP201796) primers were purchased from Origene (MD, USA).

Techniques: Western Blot, Enzyme-linked Immunosorbent Assay

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: Fluorescence-activated cell sorter (FACS) analysis of the frequency of peripheral blood CXCR5 + CD4 + T cells in patients with chronic HBV infection patients. (A) Gating strategy. (B) The percentage of circulating CXCR5 + CD4 + T cells was compared between the two groups. (C) The percentage of CXCR5 + CD4 + T cells was significantly higher in patients with chronic HBV infection than in healthy controls (P < 0.05). (D) Comparison of the frequency of CXCR5 + CD4 + T cells in the IT, IC, CHB(HBeAg+), CHB(HBeAg-) and HC groups. HC, healthy controls; HBV, patients with chronic HBV infection; IT, immune tolerant carrier; IC, inactive carrier; CHB 1 , HBeAg-negative chronic hepatitis B; CHB 2 , HBeAg-positive chronic hepatitis B; PI, propidium iodide. The horizontal lines represent the median values (±SEM).

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques: Fluorescence, Infection, Comparison

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: The phenotype of circulating TFH cells was assessed in patients with chronic HBV infection and in HC. (A) The expression of ICOS, PD-1, CD40L and IL-21R by CXCR5 + CD4 + T cells were detected by flow cytometry. At least 50,000 events were analyzed for each sample, and the data represent different groups of samples from at least two independent experiments. (B) , (D) , (F) and (H) Comparison of the percentages of ICOS + CXCR5 + CD4 + T cells, PD-1 + CXCR5 + CD4 + T cells, CD40L + CXCR5 + CD4 + T cells, and IL-21R + CXCR5 + CD4 + T cells in the chronic HBV infection and HC groups. (C) , (E) , (G) and (I) Comparison of the percentages of ICOS + CXCR5 + CD4 + T cells, PD-1 + CXCR5 + CD4 + T cells, CD40L + CXCR5 + CD4 + T cells, and IL-21R + CXCR5 + CD4 + T cells between the IT, IC, CHB(HBeAg+), CHB(HBeAg-) and HC groups. CHB 1 , HBeAg-negative chronic hepatitis B; CHB 2 , HBeAg-positive chronic hepatitis B. Each data point represents an individual subject. *, p < 0.05; **, p < 0.01.

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques: Infection, Expressing, Flow Cytometry, Comparison

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: mRNA expression levels were determined by real-time PCR. Increased expression of BCL-6, CXCR5, IL-6R, IL-4, and IL-21 mRNA in CXCR5 + CD4 + T cells in patients with chronic HBV infection (n = 16) compared to healthy controls (n = 16). Data are presented as the mean ± SD. *,p < 0.05; **, p < 0.01.

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Infection

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: The correlation between CXCR5 + CD4 + T cells and clinical parameters in patients with chronic HBV infection. (A) The correlation between the percentage of CXCR5 + CD4 + T cells and serum levels of ALT. (B) The correlation between the percentage of CXCR5 + CD4 + T cells and serum levels of AST. (C) The correlation between the percentage of CXCR5 + CD4 + T cells and HBV DNA loads. Data were expressed as the mean values of individual patients (n = 38) from three separate experiments.

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques: Infection

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: The correlation between CXCR5 + CD4 + T cells and clinical parameters in HBeAg-positive chronic hepatitis B patients. (A) The correlation between the percentage of CXCR5 + CD4 + T cells and serum levels of AST. (B) The correlation between the percentage of ICOS + CXCR5 + CD4 + T cells and HBV DNA loads. (C) The correlation between the percentage of PD-1 + CXCR5 + CD4 + T cells and HBV DNA loads. Data were expressed as the mean values of individual patients (n = 14) from three separate experiments.

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques:

Journal: Virology Journal

Article Title: Expansion of circulating TFH cells and their associated molecules: involvement in the immune landscape in patients with chronic HBV infection

doi: 10.1186/1743-422X-11-54

Figure Lengend Snippet: The correlation between CXCR5 + CD4 + T cells and clinical parameters in inactive carriers. (A) The correlation between the percentage of ICOS + CXCR5 + CD4 + T cells and AST. (B) The correlation between the percentage of PD-1 + CXCR5 + CD4 + T cells and AST. (C) The correlation between the percentage of CD40L + CXCR5 + CD4 + T cells and AST. Data were expressed as the mean values of individual patients (n = 10) from three separate experiments.

Article Snippet: The following primers were used: GAPDH (NSO_1236141_039, NSO_1236141_040, Invitrogen), BCL-6 (HP 205513, Origene), CXCR5 (HP205521, Origene), IL-6R (HP200535, Origene), IL-4 (HP200556, Origene), and IL-21 (HP214222, Origene).

Techniques: